The Wermeling lab YouTube channel –>  link

Seems like a great resource! The software can be found here , and the publication can be found here.

Can be used in several ways, but seems very useful to identify potential off target activity of a gRNA:

• choose organism
• input the gRNA followed by PAM (e.g. 20+3 bp) in FASTA format, e.g.:

>test

gctagctgagctgagcttgacgg (cgg=PAM in this case)

• select nuclease
• press submit

You can also input a longer sequence and Breaking Cas will suggest different gRNAs to target the region.

 

 

“FNDC4 acts as an anti-inflammatory factor on macrophages and improves colitis in mice”

 

http://www.nature.com/ncomms/2016/160412/ncomms11314/full/ncomms11314.html

Design and synthesis of a minimal bacterial genome.

http://science.sciencemag.org/content/351/6280/aad6253

http://www.dn.se/nyheter/vetenskap/en-sax-for-gener-kan-fa-nobelpris/

CRISPR everywhere

Illustration by Chris Labrooy

http://www.nature.com/nature/journal/v531/n7593/index.html

“The Swedish Rheumatism Association [Svenska Reumatikerförbundet] is a non-profit organisation working for people with rheumatic disorders.” link

Click to access NYA2008.pdf

 http://dgidb.genome.wustl.edu/

“Stiftelsen skapades 1953 genom en donation av dåvarande överintendenten Åke Wiberg. Den har under sin existens gett anslag till vetenskaplig forskning och till vård och utbildning av barn och ungdom. Av hävd har Stiftelsen framför allt stött medicinsk forskning men även forskning inom humaniora och samhällsvetenskap.” link