Long Jiang, MD, has received a scholarship from CSC to join the lab as a PhD student during autumn 2016!

Long Jiang / PhD student (To be registered autumn 2016- )

• Bachelor of Clinical Medicine from Tongji Medical College, Huazhong University of Science and Technology (HUST), Hubei, China.
• Master of Medical Science from Peking University (PKU), Beijing, China.
• Awarded the Chinese Scholarship Council (CSC) scholarship, and the top prize of the Chinese National Medical Students Clinical Skills Competition.

 

The Wermeling lab YouTube channel –>  link

Seems like a great resource! The software can be found here , and the publication can be found here.

Can be used in several ways, but seems very useful to identify potential off target activity of a gRNA:

• choose organism
• input the gRNA followed by PAM (e.g. 20+3 bp) in FASTA format, e.g.:

>test

gctagctgagctgagcttgacgg (cgg=PAM in this case)

• select nuclease
• press submit

You can also input a longer sequence and Breaking Cas will suggest different gRNAs to target the region.

 

 

“FNDC4 acts as an anti-inflammatory factor on macrophages and improves colitis in mice”

 

http://www.nature.com/ncomms/2016/160412/ncomms11314/full/ncomms11314.html

Design and synthesis of a minimal bacterial genome.

http://science.sciencemag.org/content/351/6280/aad6253

http://www.dn.se/nyheter/vetenskap/en-sax-for-gener-kan-fa-nobelpris/

CRISPR everywhere

Illustration by Chris Labrooy

http://www.nature.com/nature/journal/v531/n7593/index.html

“The Swedish Rheumatism Association [Svenska Reumatikerförbundet] is a non-profit organisation working for people with rheumatic disorders.” link

Click to access NYA2008.pdf

 http://dgidb.genome.wustl.edu/