Breaking Cas!

Seems like a great resource! The software can be found here , and the publication can be found here.

Can be used in several ways, but seems very useful to identify potential off target activity of a gRNA:

  • choose organism
  • input the gRNA followed by PAM (e.g. 20+3 bp) in FASTA format, e.g.:

>test

gctagctgagctgagcttgacgg (cgg=PAM in this case)

  • select nuclease
  • press submit

You can also input a longer sequence and Breaking Cas will suggest different gRNAs to target the region.