Seems like a great resource! The software can be found here , and the publication can be found here.
Can be used in several ways, but seems very useful to identify potential off target activity of a gRNA:
- choose organism
- input the gRNA followed by PAM (e.g. 20+3 bp) in FASTA format, e.g.:
>test
gctagctgagctgagcttgacgg (cgg=PAM in this case)
- select nuclease
- press submit
You can also input a longer sequence and Breaking Cas will suggest different gRNAs to target the region.
The Wermeling lab at the Karolinska Institutet 