Duhlin A, Chen Y, Wermeling F, Sedimbi SK, Lindh E, Shinde R, Halaby MJ, Kaiser Y, Winqvist O, McGaha TL, Karlsson MC.
J Immunol. 2016 Aug 24. pii: 1401129. [Epub ahead of print]
- PMID: 27559051
The Wermeling lab at the Karolinska Institutet
– Research related to Autoimmunity, Cancer immunotherapy, and CRISPR/Cas9
Duhlin A, Chen Y, Wermeling F, Sedimbi SK, Lindh E, Shinde R, Halaby MJ, Kaiser Y, Winqvist O, McGaha TL, Karlsson MC.
J Immunol. 2016 Aug 24. pii: 1401129. [Epub ahead of print]
Marginal zone macrophages (MZM) are strategically located in the spleen, lining the marginal sinus where they sense inflammation and capture Ag from the circulation. One of the receptors expressed by MZM is scavenger receptor macrophage receptor with collagenous structure (MARCO), which has affinity for modified self-antigens. In this article, we show that engagement of MARCO on murine macrophages induces extracellular ATP and loss of CD21 and CD62L on marginal zone B cells. Engagement of MARCO also leads to reduction of Ag transport by marginal zone B cells and affects the subsequent immune response. This study highlights a novel function for MZM in regulating Ag transport and activation, and we suggest that MARCO-dependent ATP release regulates this through shedding of CD21 and CD62L. Because systemic lupus erythematosus patients were shown to acquire autoantibodies against MARCO, this highlights a mechanism that could affect a patient’s ability to combat infections.
Copyright © 2016 by The American Association of Immunologists, Inc.
To kill target cells, natural killer (NK) cells organize signaling from activating and inhibitory receptors to form a lytic synapse. Wiskott-Aldrich syndrome (WAS) patients have loss-of-function mutations in the actin regulator WASp and suffer from immunodeficiency with increased risk to develop lymphoreticular malignancies. NK cells from WAS patients fail to form lytic synapses, however, the functional outcome in vivo remains unknown. Here, we show that WASp KO NK cells had decreased capacity to degranulate and produce IFNγ upon NKp46 stimulation and this was associated with reduced capacity to kill MHC class I-deficient hematopoietic grafts. Pre-treatment of WASp KO NK cells with IL-2 ex vivo restored degranulation, IFNγ production, and killing of MHC class I negative hematopoietic grafts. Moreover, WASp KO mice controlled growth of A20 lymphoma cells that naturally produced IL-2. WASp KO NK cells showed increased expression of DNAM-1, LAG-3, and KLRG1, all receptors associated with cellular exhaustion and NK cell memory. NK cells isolated from WAS patient spleen cells showed increased expression of DNAM-1 and had low to negative expression of CD56, a phenotype associated with NK cells exhaustion. Finally, in a cohort of neuroblastoma patients we identified a strong correlation between WASp, IL-2, and patient survival.
Short video on how to use the demo feature of Green Listed link (about 2 min)
PAM independent (!) cleavage using a 5´phosphorylated DNA (!) guide and Natronobacterium gregoryi Argonaute!
–>
DNA-guided genome editing using the Natronobacterium gregoryi Argonaute.
Gao F, Shen XZ, Jiang F, Wu Y, Han C.
Nat Biotechnol. 2016 May 2. doi: 10.1038/nbt.3547. [Epub ahead of print]
CRISPR-based approaches have quickly become a favored method to perturb genes to uncover their functions. Here, we review the key considerations in the design of genome editing experiments, and survey the tools and resources currently available to assist users of this technology.
Long Jiang, MD, has received a scholarship from CSC to join the lab as a PhD student during autumn 2016!
Long Jiang / PhD student (To be registered autumn 2016- )
The Wermeling lab YouTube channel –> link
Seems like a great resource! The software can be found here , and the publication can be found here.
Can be used in several ways, but seems very useful to identify potential off target activity of a gRNA:
>test
gctagctgagctgagcttgacgg (cgg=PAM in this case)
You can also input a longer sequence and Breaking Cas will suggest different gRNAs to target the region.
http://www.nature.com/ncomms/2016/160412/ncomms11314/full/ncomms11314.html